Dox your DNA

オウム 2 said:
I did one on a deep discount since my dad was adopted, we thought he was Russian - he was that plus Balkan. Mom was various white people plus some Native and like .5 black and 90 plus percent more Neanderthal than other testers. Can I say nigger in polite company now?

Of course this is 23andMe, DNALand has me as 0 native and black but like 4% Indo-Iranian including Kalash, Brahui, and Balouchi, so can I say, gypsy, or sand nigger or is that an Arabian term? Regardless it all shows that this shit doesn't tell anything if two tests can be so different.
Click to expand...


I'd trust 23andMe above anything else, just because the CEO is the wife of a Sergey Brin (Google's top 2 cofounder) and she can get away with openly poaching Google employees.
 
  • Informative
Reactions: Spastic Colon
So many DNA samples, so many potential hosts for Baby Face!
maxresdefault.jpg
 
queerape said:
DNA tests would be useless for me: "You are from India, Pakistan, Afghanistan or Iran." "ok"
Click to expand...
Yeah, it's really only useful for colonial fags who don't know where their ancestors are from. After my dad died and we got to baby-making age my mom was worried if we had some unknown genetic fuck up but my siblings and I ended up average as fuck as far as whatever mutations 23andMe test for, at least according to what the fragment of your dna shows, since they only test a fraction of your dna. If you want to sequence your full genome it's still a shit ton of money as far as I know.
 
  • Like
Reactions: queerape
I did two DNA tests in hopes of finding my biological father (one night stand, never met him...Mom didn't even remember his name). First one was a bust, but I found him AND my half sister from the second one. So...That was pretty awesome.
 
  • Feels
  • Informative
Reactions: Cat Phuckers, M0JY0, オウム 2 and 5 others
This surprise for me was ''middle east/central Asia'' at 20%. I did not have much contact with by biological father and did not know his family. After the DNA test results I looked into his family history in the last few months and his father immigrated to Windsor Ontario from ''Iran''.
 
Mine keeps changing. It used to be English/Irish/Scottish/French/Swedish -- now it's switched to English/Scottish/Irish/Welsh/Swedish/Norwegian. Needless to say I don't really think the science behind all of it is particularly good. My kid ended up with things that neither his dad nor I have -- not sure how that even works. (And no, husband is definitely the father -- no other possibilities unless immaculate conception or alien abduction are on the table.)
 
  • Like
Reactions: Cat Phuckers
Bored Housewife said:
I did two DNA tests in hopes of finding my biological father (one night stand, never met him...Mom didn't even remember his name). First one was a bust, but I found him AND my half sister from the second one. So...That was pretty awesome.
Click to expand...
Which test company was a bust, and which one worked?
 
I had some DNA screenshots stolen from /pol/ that I would post in random places because it was 3 pages of 99% ashkenazi DNA results, but they were on a workstation that I can't access from home thanks to quarantine. I need to cloud my memes and random images.
 
ggccgacgtggtgccctctccctagctcgaaaggtacctgcaagaggcgaatcactagca gggagtacacgcttcccgccggtactcagttcgttgcagatgccacctgcgtcttgactg actaataggttaactcaacaagcgaccgcggtccatgcatatacacagaggaacgatcgt cggcttaacgctagagttatagcgttagccactaattgtggagctgcgtctcaaacaatg cggcgattacaccttgcatattttataggtgaaaacgctaacccgtgattggcgactgaa tttggtctaccaaaggcgcccctccttcagatatgtcagaccgctgcgactaccgaaact gcctcaagctcccctgcatcgaccaggtggcgcccgaatgatcgtttcggcctggacact ggaccgatgagggttccaagctgagctgtgcgtctgagacgagcttcctatacaaaactg tgaacatatgtggatcttggtgaggtcatgtcggctagcagagaataatttgccaagatc cgtcagtgcgttcgaaccctacacttgctatccctgggacgatcctaatacatgtttatt gaactagccgatttccgggtcagaacgaattgatcggccagtaaccgaaagcgtgctggg cgggaatcgcggtccggctagatgtgaagtaggcgccatctgatgtaccgttgcaactca cgtgcccggagcacagtgataagtagtttcgatatcaaaatgtggtgcgagaacgcatcg gacactttatagtgacaaggctacagaagagacctctaacgtacaaatgcgtatgccgaa ctagaggtccgaactccccctatcccggtctcgtctgctaccttagtgcattagaaacac cattcactgattcaaggctgcccgtttgagtgttctcttaggaggtacaaatactaacta tcta
Yeah nevermind I don't think I can post it in its entirety.
 
  • Like
Reactions: Picklechu
You must log in or register to reply here.
Back